Skip to main content

pT3-EF1α-Dest
(Plasmid #133299)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133299 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT3-EF1α-Dest
  • Backbone size (bp) 6783
  • Vector type
    Mammalian Expression
  • Promoter EF1α

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer EF-1aforward: TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer pcDNA3.1BGHRev: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT3-EF1α-Dest was a gift from Xin Chen (Addgene plasmid # 133299 ; http://n2t.net/addgene:133299 ; RRID:Addgene_133299)
  • For your References section:

    Integration of genomic analysis and in vivo transfection to identify sprouty 2 as a candidate tumor suppressor in liver cancer. Lee SA, Ho C, Roy R, Kosinski C, Patil MA, Tward AD, Fridlyand J, Chen X. Hepatology. 2008 Apr;47(4):1200-10. doi: 10.1002/hep.22169. 10.1002/hep.22169 PubMed 18214995