Skip to main content

pUC-GFP-MCC
(Plasmid #133307)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133307 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSF_UC_OXB20-daGFP
  • Backbone manufacturer
    Oxford Genetics
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 9521
  • Modifications to backbone
    original SC101 ori replaced with pUC ori
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microcin-V bacteriocin cassette
  • Alt name
    mccV
  • Species
    E. coli
  • Mutation
    N112D (please see depositors comments)
  • Entrez Gene
    cvaC (a.k.a. CR540_RS26765, CR540_28145)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ACTGCTGATCGAGTGTAGCCA
  • 3′ sequencing primer CTGTGAGCTGAAGGTACGCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original mccV cassette from:
Gilson, L., Mahanty, H.K. and Kolter, R., 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. Journal of bacteriology, 169(6), pp.2466-2470.
PMID: 3034857

Depositor confirms N112D mutation in the first insert does not affect function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC-GFP-MCC was a gift from Chris Barnes (Addgene plasmid # 133307 ; http://n2t.net/addgene:133307 ; RRID:Addgene_133307)
  • For your References section:

    Two New Plasmid Post-segregational Killing Mechanisms for the Implementation of Synthetic Gene Networks in Escherichia coli. Fedorec AJH, Ozdemir T, Doshi A, Ho YK, Rosa L, Rutter J, Velazquez O, Pinheiro VB, Danino T, Barnes CP. iScience. 2019 Apr 26;14:323-334. doi: 10.1016/j.isci.2019.03.019. Epub 2019 Mar 22. 10.1016/j.isci.2019.03.019 PubMed 30954530