pGL4-eIF3B MBE2 mutant
(Plasmid
#133309)
-
PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.10
-
Backbone manufacturerpromega
- Backbone size w/o insert (bp) 4242
- Total vector size (bp) 5829
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeIF3B promoter MBE2 mutant
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1612
-
Mutationgccacatgcacc changed to gcAaAaAAcacc
-
GenBank IDNM_003751 NM_001037283
-
Entrez GeneEIF3B (a.k.a. EIF3-ETA, EIF3-P110, EIF3-P116, EIF3S9, PRT1)
- Promoter eIF3B
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer 5′-d(CTAGCAAAATAGGCTGTCCC)-3 or ' 5′-d(GACGATAGTCATGCCCCGCG)-3
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-eIF3B MBE2 mutant was a gift from Josep Domingo-Domenech (Addgene plasmid # 133309 ; http://n2t.net/addgene:133309 ; RRID:Addgene_133309) -
For your References section:
Master transcription factor reprograming unleashes selective translation promoting castration resistance and immune evasion in lethal prostate cancer. Santasusagna S, Zhu S, Jawalagatti V, Carceles-Cordon M, Ertel A, Garcia-Longarte S, Song WM, Fujiwara N, Li P, Mendizabal I, Petrylak DP, Kelly WK, Reddy EP, Wang L, Schiewer MJ, Lujambio A, Karnes J, Knudsen KE, Cordon-Cardo C, Dong H, Huang H, Carracedo A, Hoshida Y, Rodriguez-Bravo V, Domingo-Domenech J. Cancer Discov. 2023 Sep 7. doi: 10.1158/2159-8290.CD-23-0306. 10.1158/2159-8290.CD-23-0306 PubMed 37676710