Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
(Plasmid #133345)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133345 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBXMCS-2
  • Backbone size w/o insert (bp) 5287
  • Total vector size (bp) 5515
  • Modifications to backbone
    xylR operator removed
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA_blaA
  • Species
    Streptococcus thermophilus
  • Insert Size (bp)
    270
  • Promoter constitutive

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCTGATCCTCGCCCGAAAC
  • 3′ sequencing primer TTTTCCCAGTCACGACGTTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA was a gift from Michael Laub (Addgene plasmid # 133345 ; http://n2t.net/addgene:133345 ; RRID:Addgene_133345)
  • For your References section:

    A CRISPR Interference System for Efficient and Rapid Gene Knockdown in Caulobacter crescentus. Guzzo M, Castro LK, Reisch CR, Guo MS, Laub MT.. mBio 10.1128/mBio.02415-19