Major Sat-BUB1
(Plasmid
#133350)
-
PurposeExpress a TALE construct that recognizes major satellite repeats fused to mClover and the kinase domain of mouse BUB1 (aa 672-1058) at the C terminus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTALYM3B15
-
Backbone manufacturerMaria-Elena Torres-Padilla
- Total vector size (bp) 9067
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBUB1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1161
-
Mutationdeleted amino acids 1-671
-
Entrez GeneBub1 (a.k.a. AL022991, Bub1a, C80208, D2Xrf8, D2Xrf87)
-
Tag
/ Fusion Protein
- mClover (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGACGAGCTGTACAAGGGTGGTGAGGCTTTTAAATGCACAGG
- 3′ sequencing primer GTACCTTAAGCCTAGGTTATTTTCTTGAACGCTTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Major Sat-BUB1 was a gift from Michael Lampson (Addgene plasmid # 133350 ; http://n2t.net/addgene:133350 ; RRID:Addgene_133350) -
For your References section:
Molecular Strategies of Meiotic Cheating by Selfish Centromeres. Akera T, Trimm E, Lampson MA. Cell. 2019 Aug 22;178(5):1132-1144.e10. doi: 10.1016/j.cell.2019.07.001. Epub 2019 Aug 8. 10.1016/j.cell.2019.07.001 PubMed 31402175