Skip to main content

TfR-sfGFP-myc tag-SpyCatcher003
(Plasmid #133451)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133451 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR4
  • Backbone size w/o insert (bp) 4766
  • Total vector size (bp) 6172
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TfR-sfGFP-myc tag-SpyCatcher003
  • Species
    Synthetic
  • Insert Size (bp)
    1410
  • Mutation
    Contains C20 and A23 mutations that improve plasma membrane display of the transferrin receptor (TfR)
  • Promoter CMV
  • Tags / Fusion Proteins
    • GSSGS (C terminal on insert)
    • myc tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer BGHFor (GACAGACTAACAGACTGTTCCTTTCC)
  • 3′ sequencing primer BGH reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TfR-sfGFP-myc tag-SpyCatcher003 was a gift from Mark Howarth (Addgene plasmid # 133451 ; http://n2t.net/addgene:133451 ; RRID:Addgene_133451)
  • For your References section:

    Approaching infinite affinity through engineering of peptide-protein interaction. Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, Hytonen VP, Howarth M. Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116. 10.1073/pnas.1909653116 PubMed 31822621