pHD-SPARC2-S-LexA::p65
(Plasmid #133564)

• Purpose: Swap out effector and terminator to generate SPARC2-S CRISPR-donor vector for CRISPR-HDR genomic insertion near the attP40 locus
• Depositing Lab: Tom Clandinin
• Publication: SPARC: a method to genetically manipulate precise proportions of cells. (unpublished)

Backbone

• Vector backbone: pHD-3XP3-DsRed-DattP-CRISPR-donor-attP40
  (Search Vector Database)
• Backbone manufacturer: Isaacman-Beck et al., 2019
• Backbone size w/o insert (bp): 8307
• Total vector size (bp): 10007
• Vector type: Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LexA::p65
• Promoter: 20X UAS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGACTACCTGGCCGTTCCT
• 3′ sequencing primer: AGCGACCACCCGATCCAGC

Resource Information

• Supplemental Documents:
  • pHD-SPARC2-S-LexAp65.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry