Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #133748)


Item Catalog # Description Quantity Price (USD)
Plasmid 133748 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgagcggataacaatttcacacagg
  • 3′ sequencing primer ttacccgccaatatatcctg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFRm43GW was a gift from Niko Geldner (Addgene plasmid # 133748 ; ; RRID:Addgene_133748)
  • For your References section:

    An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420