Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #133749)


Item Catalog # Description Quantity Price (USD)
Plasmid 133749 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10455
  • Total vector size (bp) 14088
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Wild type EGFR-HA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MLU1 (unknown if destroyed)
  • 3′ cloning site SPE1 (unknown if destroyed)
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PWPXLD-EGFR-WT was a gift from Chay Kuo (Addgene plasmid # 133749 ; ; RRID:Addgene_133749)
  • For your References section:

    EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056. 10.1016/j.celrep.2019.07.056 PubMed 31433979