PWPXLD-GFP-Numb-S276D
(Plasmid
#133752)
-
PurposeNumb with mutation at serine 276 converted to aspartic acid cand tagged with GFP cloned into PWPXLD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePWPXLD
- Backbone size w/o insert (bp) 10455
- Total vector size (bp) 12417
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNUMB endocytic adaptor protein
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1962
-
Mutationserine 276 converted to aspartic acid
-
GenBank IDNM_001136075.2
-
Entrez GeneNumb (a.k.a. Nb)
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PME1 (destroyed during cloning)
- 3′ cloning site SMA1 (destroyed during cloning)
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PWPXLD-GFP-Numb-S276D was a gift from Chay Kuo (Addgene plasmid # 133752 ; http://n2t.net/addgene:133752 ; RRID:Addgene_133752) -
For your References section:
EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. Cell Rep. 2019 Aug 20;28(8):2012-2022.e4. doi: 10.1016/j.celrep.2019.07.056. 10.1016/j.celrep.2019.07.056 PubMed 31433979