Skip to main content

pLVX-Puro-TDP-43-WT
(Plasmid #133753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    plvx-puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8102
  • Total vector size (bp) 9353
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TDP-43
  • Alt name
    TARDBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1245
  • GenBank ID
    NM_007375
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcgtgtacggtgggagg
  • 3′ sequencing primer gcatgctccagactgccttgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #28205
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-Puro-TDP-43-WT was a gift from Shawn Ferguson (Addgene plasmid # 133753 ; http://n2t.net/addgene:133753 ; RRID:Addgene_133753)
  • For your References section:

    Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135