pLVX-Puro-TDP-43-P112H
(Plasmid
#133760)
-
PurposeLentiviral expression of human TDP-43 P112H disease mutant in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplvx-puro
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 8102
- Total vector size (bp) 9353
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTDP-43
-
Alt nameTARDBP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1215
-
MutationChanged proline 112 to histidine.
-
GenBank IDNM_007375
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcgtgtacggtgggagg
- 3′ sequencing primer gcatgctccagactgccttgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-Puro-TDP-43-P112H was a gift from Shawn Ferguson (Addgene plasmid # 133760 ; http://n2t.net/addgene:133760 ; RRID:Addgene_133760) -
For your References section:
Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135