Skip to main content
Addgene
Open Menu

px459-TDP-43 sgRNA1
(Plasmid #133762)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133762 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 133762-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 133762-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro V2.0
  • Backbone manufacturer
    Addgene# 62988 from Feng Zhang
  • Backbone size w/o insert (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TDP-43
  • Alt name
    TARDBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • GenBank ID
    nm_007375
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (unknown if destroyed)
  • 3′ cloning site Bbs1 (unknown if destroyed)
  • 5′ sequencing primer tttatggcgaggcggcgg
  • 3′ sequencing primer gtgggcttgtactcggtcat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459-TDP-43 sgRNA1 was a gift from Shawn Ferguson (Addgene plasmid # 133762 ; http://n2t.net/addgene:133762 ; RRID:Addgene_133762)

  • For your References section:

    Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135
Related items:
Commonly requested with: