px459-TDP-43 sgRNA1
(Plasmid
#133762)
-
PurposeExpresses Cas9 and human TDP-43 sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro V2.0
-
Backbone manufacturerAddgene# 62988 from Feng Zhang
- Backbone size w/o insert (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTDP-43
-
Alt nameTARDBP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
GenBank IDnm_007375
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (unknown if destroyed)
- 3′ cloning site Bbs1 (unknown if destroyed)
- 5′ sequencing primer tttatggcgaggcggcgg
- 3′ sequencing primer gtgggcttgtactcggtcat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-TDP-43 sgRNA1 was a gift from Shawn Ferguson (Addgene plasmid # 133762 ; http://n2t.net/addgene:133762 ; RRID:Addgene_133762) -
For your References section:
Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135