px459-Rheb sgRNA
(Plasmid
#133768)
-
PurposeExpresses Cas9 and human Rheb sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepspCas9(BB)-2A-Puro V2.0
-
Backbone manufacturerAddgene# 62988 from Feng Zhang
- Backbone size w/o insert (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRheb sgRNA
-
Alt nameRas Homolog Enriched In Brain sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (unknown if destroyed)
- 3′ cloning site Bbs1 (unknown if destroyed)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- 3′ sequencing primer gtgggcttgtactcggtcat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/513473v3 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-Rheb sgRNA was a gift from Shawn Ferguson (Addgene plasmid # 133768 ; http://n2t.net/addgene:133768 ; RRID:Addgene_133768) -
For your References section:
Weak membrane interactions allow Rheb to activate mTORC1 signaling without major lysosome enrichment. Angarola B, Ferguson SM. Mol Biol Cell. 2019 Oct 15;30(22):2750-2760. doi: 10.1091/mbc.E19-03-0146. Epub 2019 Sep 18. 10.1091/mbc.E19-03-0146 PubMed 31532697