pJAB988
(Plasmid
#133920)
-
PurposeminiICE-tet(M)cat(PC194)_PT7-GFP; used to integrate into JAB1000 B. subtilis XPORT strain with IPTG-inducible GFP under T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1 origin
- Total vector size (bp) 8143
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiICE-tet(M)cat(PC194)_PT7-GFP
-
SpeciesSynthetic
-
Insert Size (bp)6200
- Promoter T7 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgctatgcagatcattaataactatgtaaggttcg
- 3′ sequencing primer CACTTACTTTAGTTTTATGGAAATGAAAGATCATATCATATATAATCTAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJAB988 was a gift from Christopher Voigt (Addgene plasmid # 133920 ; http://n2t.net/addgene:133920 ; RRID:Addgene_133920) -
For your References section:
Engineered integrative and conjugative elements for efficient and inducible DNA transfer to undomesticated bacteria. Brophy JAN, Triassi AJ, Adams BL, Renberg RL, Stratis-Cullum DN, Grossman AD, Voigt CA. Nat Microbiol. 2018 Sep;3(9):1043-1053. doi: 10.1038/s41564-018-0216-5. Epub 2018 Aug 20. 10.1038/s41564-018-0216-5 PubMed 30127494