pSHDY*in_PpetE:BCD2:mVenus
(Plasmid
#133970)
-
PurposeHeterologous, copper-inducible expression of the reporter fluorophor mVenus in Synechocystis sp. PCC 6803. Used as backbone for cloning of GOI downstream of the PpetE:BCD2 expression module.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSHDY*in
-
Backbone manufacturerAnna Behle, Dennis Dienst
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsgrowth temperature (37°C) referes to E. coli ; in Synechoccystis sp. PCC6803: 30 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemVenus
-
Alt nameNheI_mVenus_SynOpt2
-
SpeciesSynthetic
-
Mutationinserted gene is codon optimized for Synechocystis sp. PCC 6803 2nd amino acid of mVenus changed from Val to Ala
- Promoter PpetE:BCD2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ccaggaattcgcggccgc
- 3′ sequencing primer gctgccgcacagctccatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSHDY*in_PpetE:BCD2:mVenus was a gift from Pia Lindberg (Addgene plasmid # 133970 ; http://n2t.net/addgene:133970 ; RRID:Addgene_133970) -
For your References section:
High density cultivation for efficient sesquiterpenoid biosynthesis in Synechocystis sp. PCC 6803. Dienst D, Wichmann J, Mantovani O, Rodrigues JS, Lindberg P. Sci Rep. 2020 Apr 3;10(1):5932. doi: 10.1038/s41598-020-62681-w. 10.1038/s41598-020-62681-w PubMed 32246065