Skip to main content

pSHDY*in_PpetE:BCD2:AgBIS:Flag
(Plasmid #133971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133971 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSHDY*in
  • Backbone manufacturer
    Anna Behle, Dennis Dienst
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin and Spectinomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    growth temperature (37°C) referes to E. coli ; in Synechoccystis sp. PCC6803: 30 °C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AgBIS:Flag
  • Alt name
    SpeI_AgBIS_SynOpt_Flag
  • Species
    Abies grandis
  • Mutation
    inserted gene is codon optimized for Synechocystis sp. PCC 6803 3rd amino acid of AgBIS changed from Gly to Ser
  • GenBank ID
    MG052654
  • Promoter PpetE:BCD2
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (destroyed during cloning)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ccaggaattcgcggccgc
  • 3′ sequencing primer gctgccgcacagctccatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHDY*in_PpetE:BCD2:AgBIS:Flag was a gift from Pia Lindberg (Addgene plasmid # 133971 ; http://n2t.net/addgene:133971 ; RRID:Addgene_133971)
  • For your References section:

    High density cultivation for efficient sesquiterpenoid biosynthesis in Synechocystis sp. PCC 6803. Dienst D, Wichmann J, Mantovani O, Rodrigues JS, Lindberg P. Sci Rep. 2020 Apr 3;10(1):5932. doi: 10.1038/s41598-020-62681-w. 10.1038/s41598-020-62681-w PubMed 32246065