pSHDY*in_PpetE:BCD2:AgBIS:Flag
(Plasmid
#133971)
-
PurposeHeterologous, copper-inducible expression of (E)-α-bisabolene synthase from Abies grandis (AgBIS) in Synechocystis sp. PCC 6803. The AgBIS CDS is fused to a C-termial Flag-tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSHDY*in
-
Backbone manufacturerAnna Behle, Dennis Dienst
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsgrowth temperature (37°C) referes to E. coli ; in Synechoccystis sp. PCC6803: 30 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAgBIS:Flag
-
Alt nameSpeI_AgBIS_SynOpt_Flag
-
SpeciesAbies grandis
-
Mutationinserted gene is codon optimized for Synechocystis sp. PCC 6803 3rd amino acid of AgBIS changed from Gly to Ser
-
GenBank IDMG052654
- Promoter PpetE:BCD2
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ccaggaattcgcggccgc
- 3′ sequencing primer gctgccgcacagctccatag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSHDY*in_PpetE:BCD2:AgBIS:Flag was a gift from Pia Lindberg (Addgene plasmid # 133971 ; http://n2t.net/addgene:133971 ; RRID:Addgene_133971) -
For your References section:
High density cultivation for efficient sesquiterpenoid biosynthesis in Synechocystis sp. PCC 6803. Dienst D, Wichmann J, Mantovani O, Rodrigues JS, Lindberg P. Sci Rep. 2020 Apr 3;10(1):5932. doi: 10.1038/s41598-020-62681-w. 10.1038/s41598-020-62681-w PubMed 32246065