pSHDY*in_PpetE:BCD2:MrBBS:Strep
(Plasmid
#133973)
-
PurposeHeterologous, copper-inducible expression of (-)-α- bisabolol synthase from Matricaria recutita (MrBBS) in Synechocystis sp. PCC 6803. The MrBBS CDS is fused to a C-termial StrepII-tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSHDY*in
-
Backbone manufacturerAnna Behle, Dennis Dienst
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsgrowth temperature (37°C) referes to E. coli ; in Synechoccystis sp. PCC6803: 30 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMrBBS:StrepII
-
Alt nameNheI_MrBBS_SynOpt2_Strep
-
SpeciesMatricaria recutita
-
Mutationinserted gene is codon optimized for Synechocystis sp. PCC 6803 2nd/3rd amino acids of MrBBS changed from Ser/Thr to Ala/Ser
-
GenBank IDKJ020282
- Promoter PpetE:BCD2
-
Tag
/ Fusion Protein
- StrepII (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ccaggaattcgcggccgc
- 3′ sequencing primer gctgccgcacagctccatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSHDY*in_PpetE:BCD2:MrBBS:Strep was a gift from Pia Lindberg (Addgene plasmid # 133973 ; http://n2t.net/addgene:133973 ; RRID:Addgene_133973) -
For your References section:
High density cultivation for efficient sesquiterpenoid biosynthesis in Synechocystis sp. PCC 6803. Dienst D, Wichmann J, Mantovani O, Rodrigues JS, Lindberg P. Sci Rep. 2020 Apr 3;10(1):5932. doi: 10.1038/s41598-020-62681-w. 10.1038/s41598-020-62681-w PubMed 32246065