Skip to main content

pFUdioFRTeYFPW
(Plasmid #133998)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133998 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUW
  • Backbone size w/o insert (bp) 9194
  • Total vector size (bp) 10172
  • Vector type
    Mammalian Expression, Lentiviral ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eYFP
  • Alt name
    enhanced YFP
  • Insert Size (bp)
    720
  • Mutation
    inverted and flanked by two incompatible FRT sites (FRT1, FRT5)
  • Promoter UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GTTGGCGAGTGTGTTTTGTG
  • 3′ sequencing primer CATTAAAGCAGCGTATCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUdioFRTeYFPW was a gift from Elly Nedivi (Addgene plasmid # 133998 ; http://n2t.net/addgene:133998 ; RRID:Addgene_133998)
  • For your References section:

    CPG15/Neuritin Mimics Experience in Selecting Excitatory Synapses for Stabilization by Facilitating PSD95 Recruitment. Subramanian J, Michel K, Benoit M, Nedivi E. Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012. 10.1016/j.celrep.2019.07.012 PubMed 31390571