pFUdioFRTeYFPW
(Plasmid
#133998)
-
Purposeexpresses eYFP upon coexpression with the recombinase flippase (Flp)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFUW
- Backbone size w/o insert (bp) 9194
- Total vector size (bp) 10172
-
Vector typeMammalian Expression, Lentiviral ; Flp/FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeYFP
-
Alt nameenhanced YFP
-
Insert Size (bp)720
-
Mutationinverted and flanked by two incompatible FRT sites (FRT1, FRT5)
- Promoter UbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GTTGGCGAGTGTGTTTTGTG
- 3′ sequencing primer CATTAAAGCAGCGTATCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUdioFRTeYFPW was a gift from Elly Nedivi (Addgene plasmid # 133998 ; http://n2t.net/addgene:133998 ; RRID:Addgene_133998) -
For your References section:
CPG15/Neuritin Mimics Experience in Selecting Excitatory Synapses for Stabilization by Facilitating PSD95 Recruitment. Subramanian J, Michel K, Benoit M, Nedivi E. Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012. 10.1016/j.celrep.2019.07.012 PubMed 31390571