Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFudioFRTPSD-95TealW
(Plasmid #134299)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134299 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUW
  • Backbone size w/o insert (bp) 9452
  • Total vector size (bp) 12389
  • Modifications to backbone
    Insert is inverted with respect to the promoter and is flanked by incompatible FRT sites (FRT1, FRT5).
  • Vector type
    Mammalian Expression, Lentiviral ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PSD-95-Teal
  • Alt name
    SAP-90, DLG4
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
    2937
  • Entrez Gene
    Dlg4 (a.k.a. Dlgh4, PSD95, Sap90)
  • Promoter UbC
  • Tag / Fusion Protein
    • Teal (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site Mlu1 (destroyed during cloning)
  • 5′ sequencing primer GTTGGCGAGTGTGTTTTGTG
  • 3′ sequencing primer CATTAAAGCAGCGTATCCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFudioFRTPSD-95TealW was a gift from Elly Nedivi (Addgene plasmid # 134299 ; http://n2t.net/addgene:134299 ; RRID:Addgene_134299)
  • For your References section:

    CPG15/Neuritin Mimics Experience in Selecting Excitatory Synapses for Stabilization by Facilitating PSD95 Recruitment. Subramanian J, Michel K, Benoit M, Nedivi E. Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012. 10.1016/j.celrep.2019.07.012 PubMed 31390571