Skip to main content

pZS160
(Plasmid #134238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134238 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLENTI-sgRNA
  • Backbone manufacturer
    Eric Lander & David Sabatini (Addgene plasmid # 71409)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human HJURP sgRNA
  • gRNA/shRNA sequence
    GCCCTTCGAGGACACCCCGG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZS160 was a gift from Iain Cheeseman (Addgene plasmid # 134238 ; http://n2t.net/addgene:134238 ; RRID:Addgene_134238)
  • For your References section:

    Quiescent Cells Actively Replenish CENP-A Nucleosomes to Maintain Centromere Identity and Proliferative Potential. Swartz SZ, McKay LS, Su KC, Bury L, Padeganeh A, Maddox PS, Knouse KA, Cheeseman IM. Dev Cell. 2019 Oct 7;51(1):35-48.e7. doi: 10.1016/j.devcel.2019.07.016. Epub 2019 Aug 15. 10.1016/j.devcel.2019.07.016 PubMed 31422918