Skip to main content

pKM328
(Plasmid #134243)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134243 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 42230)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting PLK1 3'
  • gRNA/shRNA sequence
    CAACGTTTTTGTACATGTTCGGGTG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM328 was a gift from Iain Cheeseman (Addgene plasmid # 134243 ; http://n2t.net/addgene:134243 ; RRID:Addgene_134243)
  • For your References section:

    Quiescent Cells Actively Replenish CENP-A Nucleosomes to Maintain Centromere Identity and Proliferative Potential. Swartz SZ, McKay LS, Su KC, Bury L, Padeganeh A, Maddox PS, Knouse KA, Cheeseman IM. Dev Cell. 2019 Oct 7;51(1):35-48.e7. doi: 10.1016/j.devcel.2019.07.016. Epub 2019 Aug 15. 10.1016/j.devcel.2019.07.016 PubMed 31422918