Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBOB-C-Flag-GK5 (25-287)
(Plasmid #134263)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134263 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBOB
  • Backbone size w/o insert (bp) 8800
  • Total vector size (bp) 9600
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gk5
  • Alt name
    glycerol kinase 5 (putative)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    789
  • Mutation
    mouse Gk5 amino acids 25-287
  • GenBank ID
    NM_001368879
  • Entrez Gene
    Gk5 (a.k.a. AV095337, C330018K18Rik, G630067D24Rik)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer ggaaactgacaatcttagcgcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOB-C-Flag-GK5 (25-287) was a gift from Bruce Beutler (Addgene plasmid # 134263 ; http://n2t.net/addgene:134263 ; RRID:Addgene_134263)
  • For your References section:

    Skin-specific regulation of SREBP processing and lipid biosynthesis by glycerol kinase 5. Zhang D, Tomisato W, Su L, Sun L, Choi JH, Zhang Z, Wang KW, Zhan X, Choi M, Li X, Tang M, Castro-Perez JM, Hildebrand S, Murray AR, Moresco EMY, Beutler B. Proc Natl Acad Sci U S A. 2017 Jun 27;114(26):E5197-E5206. doi: 10.1073/pnas.1705312114. Epub 2017 Jun 12. 10.1073/pnas.1705312114 PubMed 28607088