Skip to main content

pBOB-N-3HA-GK_v1
(Plasmid #134275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134275 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBOB
  • Backbone size w/o insert (bp) 8800
  • Total vector size (bp) 10500
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gk
  • Alt name
    glycerol kinase
  • Alt name
    Gyk
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1575
  • Mutation
    524 amino acids, isoform 1
  • GenBank ID
    NM_008194
  • Entrez Gene
    Gk (a.k.a. D930012N15Rik, Gyk)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer ggaaactgacaatcttagcgcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOB-N-3HA-GK_v1 was a gift from Bruce Beutler (Addgene plasmid # 134275 ; http://n2t.net/addgene:134275 ; RRID:Addgene_134275)
  • For your References section:

    Skin-specific regulation of SREBP processing and lipid biosynthesis by glycerol kinase 5. Zhang D, Tomisato W, Su L, Sun L, Choi JH, Zhang Z, Wang KW, Zhan X, Choi M, Li X, Tang M, Castro-Perez JM, Hildebrand S, Murray AR, Moresco EMY, Beutler B. Proc Natl Acad Sci U S A. 2017 Jun 27;114(26):E5197-E5206. doi: 10.1073/pnas.1705312114. Epub 2017 Jun 12. 10.1073/pnas.1705312114 PubMed 28607088