Skip to main content

pBAD-Citroff1-R251
(Plasmid #134307)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134307 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5100
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Citroff1 R251A
  • Species
    Synthetic
  • Insert Size (bp)
    1100
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6-His tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-Citroff1-R251 was a gift from Robert Campbell (Addgene plasmid # 134307 ; http://n2t.net/addgene:134307 ; RRID:Addgene_134307)
  • For your References section:

    High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate. Zhao Y, Shen Y, Wen Y, Campbell RE. ACS Cent Sci. 2020 Aug 26;6(8):1441-1450. doi: 10.1021/acscentsci.0c00518. Epub 2020 Jul 9. 10.1021/acscentsci.0c00518 PubMed 32875085