AAVS1-TRE-SHH
(Plasmid
#134350)
-
PurposeTargeting vector for site specific integration of doxycycline inducible expression of full length human SHH cDNA into human AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePuro-iDest
- Backbone size w/o insert (bp) 8904
- Total vector size (bp) 8681
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSHH
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDNM_000193.3
-
Entrez GeneSHH (a.k.a. HHG1, HLP3, HPE3, MCOPCB5, SMMCI, ShhNC, TPT, TPTPS)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC (ATTB1)
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40pA-R)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhuman SHH cDNA was purchased from Genecopoeia, Product ID:T1004
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Puro-iDEST (Addgene #75336)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE-SHH was a gift from Lorenz Studer (Addgene plasmid # 134350 ; http://n2t.net/addgene:134350 ; RRID:Addgene_134350) -
For your References section:
Specification of positional identity in forebrain organoids. Cederquist GY, Asciolla JJ, Tchieu J, Walsh RM, Cornacchia D, Resh MD, Studer L. Nat Biotechnol. 2019 Apr;37(4):436-444. doi: 10.1038/s41587-019-0085-3. Epub 2019 Apr 1. 10.1038/s41587-019-0085-3 PubMed 30936566