Skip to main content

AAVS1-TRE-SHH
(Plasmid #134350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134350 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Puro-iDest
  • Backbone size w/o insert (bp) 8904
  • Total vector size (bp) 8681
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SHH
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1389
  • GenBank ID
    NM_000193.3
  • Entrez Gene
    SHH (a.k.a. HHG1, HLP3, HPE3, MCOPCB5, SMMCI, ShhNC, TPT, TPTPS)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTTTGTACAAAAAAGCAGGC (ATTB1)
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40pA-R)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    human SHH cDNA was purchased from Genecopoeia, Product ID:T1004

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Puro-iDEST (Addgene #75336)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TRE-SHH was a gift from Lorenz Studer (Addgene plasmid # 134350 ; http://n2t.net/addgene:134350 ; RRID:Addgene_134350)
  • For your References section:

    Specification of positional identity in forebrain organoids. Cederquist GY, Asciolla JJ, Tchieu J, Walsh RM, Cornacchia D, Resh MD, Studer L. Nat Biotechnol. 2019 Apr;37(4):436-444. doi: 10.1038/s41587-019-0085-3. Epub 2019 Apr 1. 10.1038/s41587-019-0085-3 PubMed 30936566