-
PurposeFluorescent reporter for Cre recombinase activity. Cre removes a transcription terminator, leading to RFP production.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbA-k
- Backbone size w/o insert (bp) 2432
- Total vector size (bp) 3445
-
Vector typeBacterial Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655
-
Growth instructionsWhen transformed with Opto-Cre-Vvd, store in the dark.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameW4-loxP-TT-loxP-mRFP1
-
Insert Size (bp)1013
- Promoter W4 (modified T7A1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCTTCCCCATCGGTGATGTCG
- 3′ sequencing primer TTTCGCCACCACTGATTTGAGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/786533v1 for bioRxiv preprint.
Please note: This plasmid exists as a multimer. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbAW4k-loxP-TT-loxP-mRFP1 was a gift from Mary Dunlop (Addgene plasmid # 134405 ; http://n2t.net/addgene:134405 ; RRID:Addgene_134405) -
For your References section:
Light-Inducible Recombinases for Bacterial Optogenetics. Sheets MB, Wong WW, Dunlop MJ. ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21. 10.1021/acssynbio.9b00395 PubMed 31961670