px330-UFL1 sgRNA2
(Plasmid
#134636)
-
Purposecontains sgRNA targeting human UFL1 for gene knockout
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUFL1 sgRNA2
-
gRNA/shRNA sequenceGGCCTGACTCGCAGTAGACG
-
SpeciesH. sapiens (human)
-
Entrez GeneUFL1 (a.k.a. KIAA0776, Maxer, NLBP, RCAD)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330-UFL1 sgRNA2 was a gift from Yihong Ye (Addgene plasmid # 134636 ; http://n2t.net/addgene:134636 ; RRID:Addgene_134636) -
For your References section:
UFMylation of RPL26 links translocation-associated quality control to endoplasmic reticulum protein homeostasis. Wang L, Xu Y, Rogers H, Saidi L, Noguchi CT, Li H, Yewdell JW, Guydosh NR, Ye Y. Cell Res. 2020 Jan;30(1):5-20. doi: 10.1038/s41422-019-0236-6. Epub 2019 Oct 8. 10.1038/s41422-019-0236-6 PubMed 31595041