Skip to main content

pENTR1A dn-cHSF1
(Plasmid #134724)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134724 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2291
  • Total vector size (bp) 3383
  • Vector type
    Entry Vector for Gateway Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dn-cHSF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1092
  • Mutation
    Deletion of amino acids 186-202, 379−529
  • GenBank ID
    NM_005526.4 NM_005526.4
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG
  • 3′ sequencing primer GAGACACGGGCCAGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134724 ; http://n2t.net/addgene:134724 ; RRID:Addgene_134724)
  • For your References section:

    Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114