pENTR1A dn-cHSF1
(Plasmid
#134724)
-
PurposeGateway entry vector for constitutively active dominant-negative HSF1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2291
- Total vector size (bp) 3383
-
Vector typeEntry Vector for Gateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedn-cHSF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1092
-
MutationDeletion of amino acids 186-202, 379−529
-
GenBank IDNM_005526.4 NM_005526.4
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG
- 3′ sequencing primer GAGACACGGGCCAGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1A dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134724 ; http://n2t.net/addgene:134724 ; RRID:Addgene_134724) -
For your References section:
Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114