pQXCINeo-LOX-BC
(Plasmid
#134762)
-
Purposea retroviral vector to express lysyl oxidase (derived from a cancer cell line)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIN
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOX
-
SpeciesH. sapiens (human)
-
MutationR158Q relative to NP_002308.2
-
Entrez GeneLOX (a.k.a. AAT10)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA from cancer cell line
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
(22pb before ATG and +46pb after STOP codon )5'-CTTAATTAACggATCCggTCAATCTggCAAAAgg-3' (5-prime-cloning primer); 5'-ggggggggCggAATTCAgAACACCAggCACTgAT-3' (3-prime-cloning primer)
Addgene NGS detected a R158Q mutation in the LOX translation compared to NP_002308.2. The depositing laboratory confirmed that this mutation does not adversely affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQXCINeo-LOX-BC was a gift from Philippe Clezardin & Martine Croset (Addgene plasmid # 134762 ; http://n2t.net/addgene:134762 ; RRID:Addgene_134762)