Skip to main content
Addgene

pAT608_CMV/CAG_Flag-hNEIL2-PUFa-hTET1(CD)
(Plasmid #134849)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134849 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX302
  • Backbone manufacturer
    Plasmid #25896
  • Backbone size w/o insert (bp) 9573
  • Total vector size (bp) 12546
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Flag-NEILE2-PUFa-TET1(CD)
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    4614
  • Promoter CMV/CAG
  • Tag / Fusion Protein
    • Flag-NEIL2-PUFa-TET1(CD) (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer agcagcgtatccacatagcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT608_CMV/CAG_Flag-hNEIL2-PUFa-hTET1(CD) was a gift from Albert Cheng (Addgene plasmid # 134849)
  • For your References section:

    Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098