Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pFastbac1-Flag-FANCD2
(Plasmid #134904)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134904 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFastbac1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 9400
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FANCD2
  • Alt name
    Fanconi Anemia protein D2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4413
  • Mutation
    fully synthetic, codon optimized for insect expression
  • Entrez Gene
    FANCD2 (a.k.a. FA-D2, FA4, FACD, FAD, FAD2, FANCD)
  • Promoter polyhedron
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TATTCCGGATTATTCATACC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    fully synthetic gene, generated by Gene Universal

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For information regarding protein production from this plasmid, please see Tan et al, Plos One, 2020

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastbac1-Flag-FANCD2 was a gift from Andrew Deans (Addgene plasmid # 134904 ; http://n2t.net/addgene:134904 ; RRID:Addgene_134904)
  • For your References section:

    Preparation and purification of mono-ubiquitinated proteins using Avi-tagged ubiquitin. Tan W, Murphy VJ, Charron A, van Twest S, Sharp M, Constantinou A, Parker MW, Crismani W, Bythell-Douglas R, Deans AJ. PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020. 10.1371/journal.pone.0229000 PubMed 32092106