GFP-Myo 1e
(Plasmid
#134905)
-
PurposeExpression of rat Myo 1e (Myr 3) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4696
- Total vector size (bp) 8162
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 1e (rat) with 3' UTR
-
Alt nameMyr 3
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3466
-
GenBank IDX74815
-
Entrez GeneMyo1e (a.k.a. MYR5, Myr3)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Apa I (not destroyed)
- 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Myo 1e was a gift from Martin Bähler (Addgene plasmid # 134905 ; http://n2t.net/addgene:134905 ; RRID:Addgene_134905) -
For your References section:
A novel mammalian myosin I from rat with an SH3 domain localizes to Con A-inducible, F-actin-rich structures at cell-cell contacts. Stoffler HE, Ruppert C, Reinhard J, Bahler M. J Cell Biol. 1995 May;129(3):819-30. doi: 10.1083/jcb.129.3.819. 10.1083/jcb.129.3.819 PubMed 7730414