GFP-Myo 1d
(Plasmid #134906)

• Purpose: Expression of rat Myo 1d (Myr 4) in mammalian cells.
• Depositing Lab: Martin Bähler
• Publication: Bahler et al J Cell Biol. 1994 Jul;126(2):375-89. doi: 10.1083/jcb.126.2.375.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4720
• Total vector size (bp): 7868
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 1d (rat) with 3' UTR
• Alt name: Myr 4
• Species: R. norvegicus (rat)
• Insert Size (bp): 3148
• GenBank ID: X71997
• Entrez Gene: Myo1d (a.k.a. Myo1c, Myr2, Myr4)
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: Sac I (not destroyed)
• 5′ sequencing primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a L82A mutation in Myo1d. This mutation is not known to affect protein function.