Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-Myo 1e
(Plasmid #134905)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 134905 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4696
  • Total vector size (bp) 8162
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 1e (rat) with 3' UTR
  • Alt name
    Myr 3
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3466
  • GenBank ID
    X74815
  • Entrez Gene
    Myo1e (a.k.a. MYR5, Myr3)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Apa I (not destroyed)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 1e was a gift from Martin Bähler (Addgene plasmid # 134905 ; http://n2t.net/addgene:134905 ; RRID:Addgene_134905)
  • For your References section:

    A novel mammalian myosin I from rat with an SH3 domain localizes to Con A-inducible, F-actin-rich structures at cell-cell contacts. Stoffler HE, Ruppert C, Reinhard J, Bahler M. J Cell Biol. 1995 May;129(3):819-30. doi: 10.1083/jcb.129.3.819. 10.1083/jcb.129.3.819 PubMed 7730414