Skip to main content

GFP-Myo 1d
(Plasmid #134906)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134906 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4720
  • Total vector size (bp) 7868
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 1d (rat) with 3' UTR
  • Alt name
    Myr 4
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3148
  • GenBank ID
    X71997
  • Entrez Gene
    Myo1d (a.k.a. Myo1c, Myr2, Myr4)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Sac I (not destroyed)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a L82A mutation in Myo1d. This mutation is not known to affect protein function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 1d was a gift from Martin Bähler (Addgene plasmid # 134906 ; http://n2t.net/addgene:134906 ; RRID:Addgene_134906)
  • For your References section:

    Rat myr 4 defines a novel subclass of myosin I: identification, distribution, localization, and mapping of calmodulin-binding sites with differential calcium sensitivity. Bahler M, Kroschewski R, Stoffler HE, Behrmann T. J Cell Biol. 1994 Jul;126(2):375-89. doi: 10.1083/jcb.126.2.375. 10.1083/jcb.126.2.375 PubMed 8034741