GFP-Myo 1d
(Plasmid
#134906)
-
PurposeExpression of rat Myo 1d (Myr 4) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4720
- Total vector size (bp) 7868
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 1d (rat) with 3' UTR
-
Alt nameMyr 4
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3148
-
GenBank IDX71997
-
Entrez GeneMyo1d (a.k.a. Myo1c, Myr2, Myr4)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Sac I (not destroyed)
- 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a L82A mutation in Myo1d. This mutation is not known to affect protein function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Myo 1d was a gift from Martin Bähler (Addgene plasmid # 134906 ; http://n2t.net/addgene:134906 ; RRID:Addgene_134906) -
For your References section:
Rat myr 4 defines a novel subclass of myosin I: identification, distribution, localization, and mapping of calmodulin-binding sites with differential calcium sensitivity. Bahler M, Kroschewski R, Stoffler HE, Behrmann T. J Cell Biol. 1994 Jul;126(2):375-89. doi: 10.1083/jcb.126.2.375. 10.1083/jcb.126.2.375 PubMed 8034741