Skip to main content

GFP-Myo 9b
(Plasmid #134907)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134907 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4686
  • Total vector size (bp) 11535
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 9b (rat) with 3' UTR
  • Alt name
    Myr 5
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    6849
  • GenBank ID
    X77609
  • Entrez Gene
    Myo9b
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Sma I (destroyed during cloning)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See also:
Van den Boom et al.
Molecular Biology of the Cell Vol. 18, No. 4, 1507-1518, April 2007
The Myosin IXb Motor Activity Targets the Myosin IXb RhoGAP Domain as Cargo to Sites of Actin Polymerization.
Published Online:21 Feb 2007https://doi.org/10.1091/mbc.e06-08-0771

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 9b was a gift from Martin Bähler (Addgene plasmid # 134907 ; http://n2t.net/addgene:134907 ; RRID:Addgene_134907)
  • For your References section:

    A novel type of myosin implicated in signalling by rho family GTPases. Reinhard J, Scheel AA, Diekmann D, Hall A, Ruppert C, Bahler M. EMBO J. 1995 Feb 15;14(4):697-704. PubMed 7882973