-
PurposeNRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMIR
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name8xARE- minimal promoter - GFP
-
SpeciesSynthetic
- Promoter 8xARE - minimal promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer CGGATAACAATTTCACACAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTagBFP
-
SpeciesSynthetic
- Promoter SV40
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer none
- 3′ sequencing primer CACTGCATTCTAGTTGTGGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREP-8xARE-GFP-SV40-BFP was a gift from Markus Landthaler (Addgene plasmid # 134910 ; http://n2t.net/addgene:134910 ; RRID:Addgene_134910) -
For your References section:
Single-cell RNA-sequencing of herpes simplex virus 1-infected cells connects NRF2 activation to an antiviral program. Wyler E, Franke V, Menegatti J, Kocks C, Boltengagen A, Praktiknjo S, Walch-Ruckheim B, Bosse J, Rajewsky N, Grasser F, Akalin A, Landthaler M. Nat Commun. 2019 Oct 25;10(1):4878. doi: 10.1038/s41467-019-12894-z. 10.1038/s41467-019-12894-z PubMed 31653857