-
PurposeComponents for genome editing in mammalian cells with pCAG-All-in-one-hCascade and pBS-U6-crRNA-targeted.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPB-CAG-EBNXN
-
Backbone manufacturerWellcome Sanger Institute
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas3 with bpNLS
-
SpeciesE. coli
-
Insert Size (bp)2775
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTTCTCCATCTCCAGCCTCGGGGCT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-hCas3 was a gift from Tomoji Mashimo (Addgene plasmid # 134920 ; http://n2t.net/addgene:134920 ; RRID:Addgene_134920) -
For your References section:
CRISPR-Cas3 induces broad and unidirectional genome editing in human cells. Morisaka H, Yoshimi K, Okuzaki Y, Gee P, Kunihiro Y, Sonpho E, Xu H, Sasakawa N, Naito Y, Nakada S, Yamamoto T, Sano S, Hotta A, Takeda J, Mashimo T. Nat Commun. 2019 Dec 6;10(1):5302. doi: 10.1038/s41467-019-13226-x. 10.1038/s41467-019-13226-x PubMed 31811138