Skip to main content

Myo 9a-GFP
(Plasmid #134959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134959 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4719
  • Total vector size (bp) 12684
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 9a (rat) with 5' UTR
  • Alt name
    Myr 7
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    7965
  • GenBank ID
    AJ001713
  • Entrez Gene
    Myo9a
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac II (not destroyed)
  • 3′ cloning site Age I (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myo 9a-GFP was a gift from Martin Bähler (Addgene plasmid # 134959 ; http://n2t.net/addgene:134959 ; RRID:Addgene_134959)
  • For your References section:

    Myr 7 is a novel myosin IX-RhoGAP expressed in rat brain. Chieregatti E, Gartner A, Stoffler HE, Bahler M. J Cell Sci. 1998 Dec 18;111 ( Pt 24):3597-608. PubMed 9819351