Myo 9a-GFP
(Plasmid
#134959)
-
PurposeExpression of rat Myo 9a (Myr7) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4719
- Total vector size (bp) 12684
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 9a (rat) with 5' UTR
-
Alt nameMyr 7
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)7965
-
GenBank IDAJ001713
-
Entrez GeneMyo9a
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac II (not destroyed)
- 3′ cloning site Age I (not destroyed)
- 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer EGFP-N CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Myo 9a-GFP was a gift from Martin Bähler (Addgene plasmid # 134959 ; http://n2t.net/addgene:134959 ; RRID:Addgene_134959) -
For your References section:
Myr 7 is a novel myosin IX-RhoGAP expressed in rat brain. Chieregatti E, Gartner A, Stoffler HE, Bahler M. J Cell Sci. 1998 Dec 18;111 ( Pt 24):3597-608. PubMed 9819351