pAT1503_pX-SPFE-BbsI(ccdbCam)-5xPBSa
(Plasmid
#134978)
-
Purpose(Empty Backbone) Cloning vector for expression of Casilio sgRNAs containing five PUFa-binding sites (PBSa)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
- Backbone size (bp) 4723
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
- Promoter Human U6 Promoter
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagggcctatttcccatgattcc
- 3′ sequencing primer gccatttgtctgcagaattggc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT1503_pX-SPFE-BbsI(ccdbCam)-5xPBSa was a gift from Albert Cheng (Addgene plasmid # 134978) -
For your References section:
Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098