pCCl-MCS_miniCMV_miRFP703
(Plasmid
#134985)
-
PurposeThe plasmid includes a miRFP703 gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCCL
- Backbone size w/o insert (bp) 8572
- Total vector size (bp) 9292
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRFP703
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)948
- Promoter minCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atccacgctgttttgacctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCl-MCS_miniCMV_miRFP703 was a gift from Claudio Mussolino (Addgene plasmid # 134985 ; http://n2t.net/addgene:134985 ; RRID:Addgene_134985) -
For your References section:
A versatile reporter system for multiplexed screening of effective epigenome editors. Roman Azcona MS, Fang Y, Carusillo A, Cathomen T, Mussolino C. Nat Protoc. 2020 Oct;15(10):3410-3440. doi: 10.1038/s41596-020-0380-y. Epub 2020 Sep 4. 10.1038/s41596-020-0380-y PubMed 32887975