GFP-Myo 1g
(Plasmid
#134991)
-
PurposeExpression of mouse Myo 1g in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4701
- Total vector size (bp) 7782
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyo 1g
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3081
-
Entrez GeneMyo1g (a.k.a. E430002D17Rik)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Myo 1g was a gift from Martin Bähler (Addgene plasmid # 134991 ; http://n2t.net/addgene:134991 ; RRID:Addgene_134991) -
For your References section:
Myosin 1G (Myo1G) is a haematopoietic specific myosin that localises to the plasma membrane and regulates cell elasticity. Olety B, Walte M, Honnert U, Schillers H, Bahler M. FEBS Lett. 2010 Feb 5;584(3):493-9. doi: 10.1016/j.febslet.2009.11.096. Epub 2009 Dec 4. 10.1016/j.febslet.2009.11.096 PubMed 19968988