pU6-(BsaI)_CBh-UN-Cas9
(Plasmid
#135011)
-
PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerZhang lab (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8902
-
Modifications to backboneSites for cloning sgRNA changed to BsaI. Sticky ends for cloning of sgRNA are the same as the original pX330 vector. Fragment encoding 126aa domain from HSV-1 UL12 inserted to make N-terminal fusion with Flag-Cas9.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9
-
Alt nameSpCas9
-
Alt namehSpCas9
-
Specieshumanized S. pyogenes
-
Insert Size (bp)4272
-
Mutation126aa domain from HSV-1 UL12 fused to the N-terminus of Flag-Cas9
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG
- 126aa domain from HSV-1 UL12 fused to the N-terminus of Flag-Cas9 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI/SgrAI (AgeI not destroyed) (not destroyed)
- 3′ cloning site NcoI/BspHI (destroyed during cloning)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe UL12 fragment was pcr amplified from the pSAK UL12/12.5 plasmid from Sandra K. Weller's laboratory, University of Connecticut Health Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-(BsaI)_CBh-UN-Cas9 was a gift from Yosef Shaul (Addgene plasmid # 135011 ; http://n2t.net/addgene:135011 ; RRID:Addgene_135011) -
For your References section:
Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. 10.3390/biom9100584 PubMed 31597252