TPC2(N257A)-mCherry
(Plasmid
#135186)
-
PurposePore-dead mutant of TPC2, tagged on C terminus with mCherry.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVXpuro
- Backbone size w/o insert (bp) 8080
- Total vector size (bp) 10990
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTPC2
-
Alt nameTwo-pore channel 2
-
Alt nameTpcn2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2193
-
MutationMutation of asparagine257 to alanine
-
GenBank IDBC141195
-
Entrez GeneTpcn2 (a.k.a. D830047E22Rik, Gm35086)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer CCAGAGGCCACTTGTGTAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUnknown
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMAGE clone: 9055807
ImaGenes collection: IRCKp5014F1215Q
GeneBank: BC141195
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TPC2(N257A)-mCherry was a gift from Antony Galione (Addgene plasmid # 135186 ; http://n2t.net/addgene:135186 ; RRID:Addgene_135186) -
For your References section:
Expression of Ca(2)(+)-permeable two-pore channels rescues NAADP signalling in TPC-deficient cells. Ruas M, Davis LC, Chen CC, Morgan AJ, Chuang KT, Walseth TF, Grimm C, Garnham C, Powell T, Platt N, Platt FM, Biel M, Wahl-Schott C, Parrington J, Galione A. EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14. 10.15252/embj.201490009 PubMed 25872774