pB_35S/mEGFP
(Plasmid
#135320)
-
PurposemEGFP expression regulated by the CaMV35S promoter, co-expressed BASTA resistance selectable marker (bar)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB2GW7
-
Backbone manufacturerhttps://gateway.psb.ugent.be
- Backbone size w/o insert (bp) 9246
- Total vector size (bp) 9966
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemEGFP
-
Alt namemonomeric enhanceed green fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter Cauliflower mosaic virus 35S
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
- 3′ sequencing primer ATATGCTCAACACATGAGCGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymEGFP was amplified from mEGFP-pBAD, a gift from Michael Davidson (Addgene plasmid # 54622 ; http://n2t.net/addgene:54622 ; RRID:Addgene_54622).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB_35S/mEGFP was a gift from Mathias Pribil (Addgene plasmid # 135320 ; http://n2t.net/addgene:135320 ; RRID:Addgene_135320) -
For your References section:
Antimicrobial solid media for screening non-sterile Arabidopsis thaliana seeds. Behrendorff JBYH, Borras-Gas G, Pribil M. Physiol Plant. 2020 Feb 25. doi: 10.1111/ppl.13079. 10.1111/ppl.13079 PubMed 32096870