opto-Rac1
(Plasmid
#135396)
-
PurposeExpresses opto-Rac1 (BcLOV4-GGGSx2-WT_Rac1-GGGSx2-mCherry in mammalian cells in the pcDNA3.1 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 8400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameopto-Rac1
-
SpeciesH. sapiens (human); Botrytis cinerea
-
Insert Size (bp)3100
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
opto-Rac1 was a gift from Brian Chow (Addgene plasmid # 135396 ; http://n2t.net/addgene:135396 ; RRID:Addgene_135396) -
For your References section:
Optogenetic Rac1 engineered from membrane lipid-binding RGS-LOV for inducible lamellipodia formation. Berlew EE, Kuznetsov IA, Yamada K, Bugaj LJ, Chow BY. Photochem Photobiol Sci. 2020 Mar 1;19(3):353-361. doi: 10.1039/c9pp00434c. Epub 2020 Feb 12. 10.1039/c9pp00434c PubMed 32048687