-
PurposeExpresses opto-RhoA (RhoA-GGGSx2-BcLOV4-GGGSx2-mCherry) in a pcDNA3.1 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5372
- Total vector size (bp) 8492
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameopto-RhoA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3120
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
opto-RhoA-mCherry_pcDNA3.1 was a gift from Brian Chow (Addgene plasmid # 164472 ; http://n2t.net/addgene:164472 ; RRID:Addgene_164472) -
For your References section:
Single-Component Optogenetic Tools for Inducible RhoA GTPase Signaling. Berlew EE, Kuznetsov IA, Yamada K, Bugaj LJ, Boerckel JD, Chow BY. Adv Biol. 2021 Sep;5(9):e2100810. doi: 10.1002/adbi.202100810. 10.1002/adbi.202100810 PubMed 34288599