-
PurposeCan be used to drive amplified GCaMP6s expression when combined with TET driver . Can be used to create adeno-associated virus to express TET-driven GCaMP6s.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAVTREGCaMP6f
-
Backbone manufacturerTetsuo Yamamori
- Backbone size w/o insert (bp) 5830
- Total vector size (bp) 5765
-
Modifications to backboneA fragment containing GCaMP6s was swapped into replace GCaMP6f in the original backbone.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
Alt nameGCaMP3-K78H T302L R303P D380Y T381R S383T R392G
-
Alt nameGCaMP3 variant 641
-
SpeciesR. norvegicus (rat); A. victoria (jellyfish)
-
Insert Size (bp)1274
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NHEI (not destroyed)
- 5′ sequencing primer TAGCGCCACCATGGTCGACTCA
- 3′ sequencing primer GGATCCTTACTACTTCGCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 135418 ; http://n2t.net/addgene:135418 ; RRID:Addgene_135418)