CMV:eGFP-CaM-uTEV1Δ(220-242)
(Plasmid
#135461)
-
PurposeMammalian expression of uFLARE protease component
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3802
- Total vector size (bp) 1944
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP-CaM-uTEV1Δ
-
SpeciesSynthetic
-
MutationS219V mutation improves stability and S153N improves catalytic efficency
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP, V5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcaccaaaatcaacgggactttcc
- 3′ sequencing primer CAGTGGGAGTGGCACCTTCCAGGGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV:eGFP-CaM-uTEV1Δ(220-242) was a gift from Alice Ting (Addgene plasmid # 135461 ; http://n2t.net/addgene:135461 ; RRID:Addgene_135461) -
For your References section:
Directed evolution improves the catalytic efficiency of TEV protease. Sanchez MI, Ting AY. Nat Methods. 2019 Dec 9. pii: 10.1038/s41592-019-0665-7. doi: 10.1038/s41592-019-0665-7. 10.1038/s41592-019-0665-7 PubMed 31819267